Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 7 117188797 117188797 A > G CFTR NM_000492.3:c.1312A>G
NP_000483.3:p.Thr438Ala
2657/10734 0.12381 5 non_synonymous Benign
View 7 128038461 128038461 G > A IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 NM_001102605.1:c.1044+7C>T
NM_001142576.1:c.975+7C>T
NM_001142575.1:c.744+7C>T
NM_183243.2:c.966+7C>T
NM_001142574.1:c.804+7C>T
NM_001142573.1:c.819+7C>T
NM_000883.3:c.1074+7C>T
18/8685 0.00104 5 five_prime_intronic Benign
View 7 128038462 128038462 C > A IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 IMPDH1 NM_001102605.1:c.1044+6G>T
NM_001142576.1:c.975+6G>T
NM_001142575.1:c.744+6G>T
NM_183243.2:c.966+6G>T
NM_001142574.1:c.804+6G>T
NM_001142573.1:c.819+6G>T
NM_000883.3:c.1074+6G>T
18/8685 0.00104 5 five_prime_flank Benign
View 7 128480229 128480229 C > A FLNC FLNC ENST00000325888.8:c.1549+15C>A
ENST00000346177.6:c.1549+15C>A
102/8647 0.0059 4 five_prime_intronic Benign
View 7 134135621 134135621 T > C AKR1B1 NM_001628.2:c.268A>G
NP_001619.1:p.Lys90Glu
157/8685 0.0091 5 non_synonymous Benign
View 7 140477771 140477771 A > G BRAF NM_004333.4:c.1517+20T>C
20/8646 0.00116 5 five_prime_intronic Benign
View 7 142640113 142640113 A > G KEL NM_000420.2:c.1790T>C
NP_000411.1:p.Leu597Pro
141/8685 0.00841 5 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 7 150644404 150644404 G > T KCNH2 KCNH2 NM_172057.2:c.2132+12C>A
NM_000238.3:c.3152+12C>A
50/8646 0.00289 5 five_prime_intronic Benign
View 7 151875102 151875102 A > T KMT2C NM_170606.2:c.7443-7T>A
19/8685 0.00127 5 polypyrimidine_tract Benign
View 7 151945454 151945454 T > C KMT2C NM_170606.2:c.2065A>G
NP_733751.2:p.Met689Val
11/8646 0.00064 5 non_synonymous Benign
View 7 151970856 151970856 T > A KMT2C NM_170606.2:c.946A>T
NP_733751.2:p.Thr316Ser
7290/8718 0.42131 5 Benign
View 7 153750132 153750132 A > T DPP6 DPP6 ENST00000377770.3:c.227A>T
ENST00000404039.1:c.51+165313A>T
ENSP00000367001.3:p.Asp76Val
160/8686 0.00927 4 non_synonymous Benign
View 8 1728557 1728557 C > G CLN8 NM_018941.3:c.685C>G
NP_061764.2:p.Pro229Ala
168/10521 0.00822 5 Benign
View 8 10464692 10464692 A > T RP1L1 NM_178857.5:c.6916T>A
NP_849188.4:p.Trp2306Arg
22/8646 0.00127 5 non_synonymous Benign
View 8 10467624 10467625 - > ATTACTTTAGTCCCC RP1L1 NM_178857.5:c.3983_3984insGGGGACTAAAGTAAT
NP_849188.4:p.Glu1328_Glu1329insGlyThrLysValIle
142/8647 0.00885 5 in_frame_indel Benign
View 8 10467627 10467628 - > AACTGCACCCCCTCTTCTTGCAGCCCTTCTTCC RP1L1 NM_178857.5:c.3980_3981insGGAAGAAGGGCTGCAAGAAGAGGGGGTGCAGTT
NP_849188.4:p.Gly1330_Glu1340dup
144/8647 0.00896 5 in_frame_indel Benign
View 8 10469738 10469738 C > T RP1L1 NM_178857.5:c.1870G>A
NP_849188.4:p.Ala624Thr
20/8646 0.00116 5 non_synonymous Benign
View 8 11614584 11614584 G > A GATA4 NM_002052.3:c.1138G>A
NP_002043.2:p.Val380Met
68/8685 0.00397 5 Benign
View 8 11615928 11615928 G > A GATA4 NM_002052.3:c.1273G>A
NP_002043.2:p.Asp425Asn
10/8685 0.00058 5 Benign
View 8 17915126 17915126 C > T ASAH1 ASAH1 ASAH1 NM_004315.4:c.1153G>A
NM_001127505.1:c.1087G>A
NM_177924.3:c.1105G>A
NP_004306.3:p.Val385Ile
NP_001120977.1:p.Val363Ile
NP_808592.2:p.Val369Ile
87/8685 0.00518 1 Benign
View 8 21978269 21978269 C > T HR HR NM_018411.4:c.2570G>A
NM_005144.4:c.2570G>A
NP_060881.2:p.Arg857His
NP_005135.2:p.Arg857His
73/8685 0.00426 5 non_synonymous Benign
View 8 21978372 21978372 C > T HR HR NM_018411.4:c.2467G>A
NM_005144.4:c.2467G>A
NP_060881.2:p.Gly823Ser
NP_005135.2:p.Gly823Ser
80/8685 0.00466 5 non_synonymous Benign
View 8 27634589 27634589 T > C ESCO2 NM_001017420.2:c.764T>C
NP_001017420.1:p.Phe255Ser
75/10521 0.00356 5 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 8 30567424 30567424 A > T GSR GSR GSR GSR NM_001195104.1:c.334-5T>A
NM_001195103.1:c.334-5T>A
NM_001195102.1:c.334-5T>A
NM_000637.3:c.334-5T>A
34/8685 0.00213 3 polypyrimidine_tract Benign
View 8 31030535 31030535 C > T WRN NM_000553.4:c.4216C>T
NP_000544.2:p.Arg1406Ter
35/8685 0.00201 5 Benign
View 8 38271301 38271301 G > A FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 NM_023106.2:c.2041C>T
NM_001174063.1:c.2308C>T
NM_023105.2:c.2047C>T
NM_001174066.1:c.2047C>T
NM_001174067.1:c.2407C>T
NM_001174064.1:c.2284C>T
NM_001174065.1:c.2308C>T
NM_015850.3:c.2308C>T
NM_023110.2:c.2314C>T
NP_075594.1:p.Pro681Ser
NP_001167534.1:p.Pro770Ser
NP_075593.1:p.Pro683Ser
NP_001167537.1:p.Pro683Ser
NP_001167538.1:p.Pro803Ser
NP_001167535.1:p.Pro762Ser
NP_001167536.1:p.Pro770Ser
NP_056934.2:p.Pro770Ser
NP_075598.2:p.Pro772Ser
76/8685 0.00438 5 Benign
View 8 38271547 38271547 G > A FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 NM_023106.2:c.1914-6C>T
NM_001174063.1:c.2181-6C>T
NM_023105.2:c.1920-6C>T
NM_001174066.1:c.1920-6C>T
NM_001174067.1:c.2280-6C>T
NM_001174064.1:c.2157-6C>T
NM_001174065.1:c.2181-6C>T
NM_015850.3:c.2181-6C>T
NM_023110.2:c.2187-6C>T
254/8686 0.01502 5 Benign
View 8 43052839 43052839 A > C HGSNAT NM_152419.2:c.1567A>C
NP_689632.2:p.Lys523Gln
202/10521 0.01017 5 Benign
View 8 48695175 48695175 T > C PRKDC PRKDC ENST00000338368.3:c.11173-16A>G
ENST00000314191.2:c.11173-16A>G
7/8646 0.0004 5 three_prime_flank Benign
View 8 48842425 48842425 T > C PRKDC PRKDC ENST00000338368.3:c.2040A>G
ENST00000314191.2:c.2040A>G
ENSP00000345182.3:p.Ile680Met
ENSP00000313420.2:p.Ile680Met
39/8685 0.00236 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 8 61693942 61693943 - > AAAGCA CHD7 NM_017780.3:c.2053_2058dupGCAAAA
NP_060250.2:p.Ala685_Lys686dup
170/8685 0.00979 5 Benign
View 8 61778448 61778448 C > T CHD7 NM_017780.3:c.8950C>T
NP_060250.2:p.Leu2984Phe
44/8685 0.00253 5 non_synonymous Benign
View 8 68062185 68062187 TTT > - CSPP1 NM_024790.6:c.2113+34_2113+36del
104/8646 0.00601 5 five_prime_intronic Benign
View 8 77619765 77619765 T > - ZFHX4 NM_024721.4:c.2591-8del
75/8646 0.0044 5 three_prime_flank Benign
View 8 90982691 90982691 G > A NBN NM_002485.4:c.797C>T
NP_002476.2:p.Pro266Leu
39/10521 0.0019 1 Benign
View 8 100182333 100182333 G > C VPS13B VPS13B VPS13B NM_017890.4:c.2275G>C
NM_152564.4:c.2275G>C
NM_015243.2:c.2275G>C
NP_060360.3:p.Val759Leu
NP_689777.3:p.Val759Leu
NP_056058.2:p.Val759Leu
130/10521 0.00623 5 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 8 100520087 100520087 G > A VPS13B VPS13B NM_017890.4:c.4247G>A
NM_152564.4:c.4224+656G>A
NP_060360.3:p.Arg1416Gln
72/10521 0.00366 5 changed to 5 non_synonymous Benign
View 8 100654319 100654319 C > T VPS13B VPS13B NM_017890.4:c.5576C>T
NM_152564.4:c.5501C>T
NP_060360.3:p.Ser1859Leu
NP_689777.3:p.Ser1834Leu
100/10521 0.00494 5 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 8 106814597 106814597 G > A ZFPM2 NM_012082.3:c.2287G>A
NP_036214.2:p.Val763Ile
69/8685 0.00403 5 non_synonymous Benign
View 8 117868534 117868535 AA > - RAD21 NM_006265.2:c.815-6_815-5del
167/8685 0.00973 5 polypyrimidine_tract Benign
View 8 117868535 117868535 A > - RAD21 NM_006265.2:c.815-5del
84/8685 0.00501 5 polypyrimidine_tract Benign
View 8 119122313 119122316 CAGA > - EXT1 NM_000127.2:c.962+8_962+11del
82/8685 0.00484 5 Benign
View 8 133150129 133150129 C > T KCNQ3 KCNQ3 NM_004519.3:c.1700+3G>A
NM_001204824.1:c.1340+3G>A
69/8685 0.00403 5 five_prime_flank Benign
View 8 133152311 133152311 T > C KCNQ3 KCNQ3 NM_004519.3:c.1568+12A>G
NM_001204824.1:c.1208+12A>G
4/8646 0.00023 3 five_prime_intronic Benign
View 8 141294140 141294140 T > G TRAPPC9 TRAPPC9 NM_001160372.1:c.1982-20A>C
NM_031466.5:c.2276-20A>C
109/10482 0.00525 5 three_prime_flank Benign
View 8 144998620 144998620 C > T PLEC PLEC PLEC PLEC PLEC PLEC PLEC PLEC NM_201378.2:c.5435G>A
NM_201379.1:c.5411G>A
NM_000445.3:c.5558G>A
NM_201382.2:c.5477G>A
NM_201383.1:c.5489G>A
NM_201384.1:c.5477G>A
NM_201380.2:c.5888G>A
NM_201381.1:c.5381G>A
NP_958780.1:p.Arg1812Gln
NP_958781.1:p.Arg1804Gln
NP_000436.2:p.Arg1853Gln
NP_958784.1:p.Arg1826Gln
NP_958785.1:p.Arg1830Gln
NP_958786.1:p.Arg1826Gln
NP_958782.1:p.Arg1963Gln
NP_958783.1:p.Arg1794Gln
152/10521 0.00746 5 non_synonymous Benign
View 8 145582740 145582740 A > G SLC52A2 SLC52A2 SLC52A2 SLC52A2 NM_001253816.1:c.-110-104A>G
NM_001253815.1:c.-106-108A>G
NR_045600.1:n.485+15A>G
NM_024531.4:c.-110-104A>G
121/8647 0.00729 5 five_prime_intronic Benign
View 8 145738411 145738416 GGTGCA > - RECQL4 ENST00000428558.2:c.2569_2574del
ENSP00000475456.1:p.Cys857_Thr858del
78/8685 0.00449 5 in_frame_indel Benign
View 8 145738583 145738584 GG > - RECQL4 ENST00000428558.2:c.2463+18_2463+19del
3412/8650 0.21434 5 five_prime_intronic Benign
View 8 145738585 145738585 G > T RECQL4 ENST00000428558.2:c.2463+16C>A
92/8647 0.00532 5 five_prime_intronic Benign
Displaying 750 through 800 of 978 variants