Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 7 150644404 150644404 G > T KCNH2 KCNH2 NM_172057.2:c.2132+12C>A
NM_000238.3:c.3152+12C>A
64/11950 0.00268 5 curation Benign
View 7 151875102 151875102 A > T KMT2C NM_170606.2:c.7443-7T>A
24/11983 0.00113 5 curation Benign
View 7 151945454 151945454 T > C KMT2C NM_170606.2:c.2065A>G
NP_733751.2:p.Met689Val
11/13105 0.00042 5 curation Benign
View 7 151970856 151970856 T > A KMT2C NM_170606.2:c.946A>T
NP_733751.2:p.Thr316Ser
7231/13155 0.27624 5 curation Benign
View 7 153750132 153750132 A > T DPP6 DPP6 ENST00000377770.3:c.227A>T
ENST00000404039.1:c.51+165313A>T
ENSP00000367001.3:p.Asp76Val
273/13145 0.01046 4 curation Benign
View 8 1728557 1728557 C > G CLN8 NM_018941.3:c.685C>G
NP_061764.2:p.Pro229Ala
276/14969 0.00949 5 curation Benign
View 8 10464692 10464692 A > T RP1L1 NM_178857.5:c.6916T>A
NP_849188.4:p.Trp2306Arg
31/13105 0.00118 5 curation Benign
View 8 10467624 10467625 - > ATTACTTTAGTCCCC RP1L1 NM_178857.5:c.3983_3984insGGGGACTAAAGTAAT
NP_849188.4:p.Glu1328_Glu1329insGlyThrLysValIle
211/13106 0.00843 5 curation Benign
View 8 10467627 10467628 - > AACTGCACCCCCTCTTCTTGCAGCCCTTCTTCC RP1L1 NM_178857.5:c.3980_3981insGGAAGAAGGGCTGCAAGAAGAGGGGGTGCAGTT
NP_849188.4:p.Gly1330_Glu1340dup
211/13106 0.00843 5 curation Benign
View 8 10469738 10469738 C > T RP1L1 NM_178857.5:c.1870G>A
NP_849188.4:p.Ala624Thr
29/13105 0.00111 5 curation Benign
View 8 11407690 11407690 C > A BLK NM_001715.2:c.391C>A
NP_001706.2:p.Arg131=
77/13144 0.00293 5 Benign
View 8 11614584 11614584 G > A GATA4 NM_002052.3:c.1138G>A
NP_002043.2:p.Val380Met
96/13144 0.00365 5 curation Benign
View 8 11615928 11615928 G > A GATA4 NM_002052.3:c.1273G>A
NP_002043.2:p.Asp425Asn
16/13144 0.00061 5 curation Benign
View 8 17915126 17915126 C > T ASAH1 ASAH1 ASAH1 NM_004315.4:c.1153G>A
NM_001127505.1:c.1087G>A
NM_177924.3:c.1105G>A
NP_004306.3:p.Val385Ile
NP_001120977.1:p.Val363Ile
NP_808592.2:p.Val369Ile
121/13144 0.00472 1 Benign
View 8 21978269 21978269 C > T HR HR NM_018411.4:c.2570G>A
NM_005144.4:c.2570G>A
NP_060881.2:p.Arg857His
NP_005135.2:p.Arg857His
108/13144 0.00418 5 curation Benign
View 8 21978372 21978372 C > T HR HR NM_018411.4:c.2467G>A
NM_005144.4:c.2467G>A
NP_060881.2:p.Gly823Ser
NP_005135.2:p.Gly823Ser
115/13144 0.00445 5 curation Benign
View 8 23560511 23560511 C > G NKX2-6 NM_001136271.2:c.359G>C
NP_001129743.2:p.Arg120Pro
82/13144 0.00316 5 non_synonymous Benign
View 8 27634589 27634589 T > C ESCO2 NM_001017420.2:c.764T>C
NP_001017420.1:p.Phe255Ser
137/14969 0.00464 5 curation Benign
View 8 30567424 30567424 A > T GSR GSR GSR GSR NM_001195104.1:c.334-5T>A
NM_001195103.1:c.334-5T>A
NM_001195102.1:c.334-5T>A
NM_000637.3:c.334-5T>A
45/11983 0.002 3 polypyrimidine_tract Benign
View 8 31030535 31030535 C > T WRN NM_000553.4:c.4216C>T
NP_000544.2:p.Arg1406Ter
49/13144 0.00186 5 curation Benign
View 8 38271301 38271301 G > A FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 NM_023106.2:c.2041C>T
NM_001174063.1:c.2308C>T
NM_023105.2:c.2047C>T
NM_001174066.1:c.2047C>T
NM_001174067.1:c.2407C>T
NM_001174064.1:c.2284C>T
NM_001174065.1:c.2308C>T
NM_015850.3:c.2308C>T
NM_023110.2:c.2314C>T
NP_075594.1:p.Pro681Ser
NP_001167534.1:p.Pro770Ser
NP_075593.1:p.Pro683Ser
NP_001167537.1:p.Pro683Ser
NP_001167538.1:p.Pro803Ser
NP_001167535.1:p.Pro762Ser
NP_001167536.1:p.Pro770Ser
NP_056934.2:p.Pro770Ser
NP_075598.2:p.Pro772Ser
114/13144 0.00434 5 curation Benign
View 8 38271547 38271547 G > A FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 FGFR1 NM_023106.2:c.1914-6C>T
NM_001174063.1:c.2181-6C>T
NM_023105.2:c.1920-6C>T
NM_001174066.1:c.1920-6C>T
NM_001174067.1:c.2280-6C>T
NM_001174064.1:c.2157-6C>T
NM_001174065.1:c.2181-6C>T
NM_015850.3:c.2181-6C>T
NM_023110.2:c.2187-6C>T
399/12027 0.017 5 curation Benign
View 8 41519303 41519303 G > A ANK1 ANK1 ANK1 ANK1 ANK1 ANK1 ANK1 ANK1 NM_020476.2:c.5619+16C>T
NM_020475.2:c.5544+91C>T
NM_020477.2:c.5133+16C>T
NM_020478.4:c.369+91C>T
NM_001142446.1:c.5667+91C>T
NM_001142445.1:c.444+16C>T
NM_000037.3:c.5544+91C>T
NM_020480.4:c.303+1874C>T
198/11958 0.00828 5 Benign
View 8 41790713 41790714 - > GGT KAT6A KAT6A KAT6A NM_006766.3:c.5022_5024dupACC
NM_001099412.1:c.5022_5024dupACC
NM_001099413.1:c.5022_5024dupACC
NP_006757.2:p.Pro1675dup
NP_001092882.1:p.Pro1675dup
NP_001092883.1:p.Pro1675dup
15/13144 0.00057 5 curation Benign
View 8 43052839 43052839 A > C HGSNAT NM_152419.2:c.1567A>C
NP_689632.2:p.Lys523Gln
286/14969 0.01035 5 curation Benign
View 8 48695175 48695175 T > C PRKDC PRKDC ENST00000338368.3:c.11173-16A>G
ENST00000314191.2:c.11173-16A>G
12/11945 0.0005 5 curation Benign
View 8 48842425 48842425 T > C PRKDC PRKDC ENST00000338368.3:c.2040A>G
ENST00000314191.2:c.2040A>G
ENSP00000345182.3:p.Ile680Met
ENSP00000313420.2:p.Ile680Met
54/13144 0.00213 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Benign
View 8 61693942 61693943 - > AAAGCA CHD7 NM_017780.3:c.2053_2058dupGCAAAA
NP_060250.2:p.Ala685_Lys686dup
293/13144 0.01118 5 curation Benign
View 8 61757805 61757805 C > T CHD7 NM_017780.3:c.5051-4C>T
191/12005 0.00796 5 Benign
View 8 61769418 61769418 A > C CHD7 NM_017780.3:c.7579A>C
NP_060250.2:p.Met2527Leu
83/13144 0.00316 5 Benign
View 8 61778448 61778448 C > T CHD7 NM_017780.3:c.8950C>T
NP_060250.2:p.Leu2984Phe
77/13144 0.00293 5 curation Benign
View 8 68062185 68062187 TTT > - CSPP1 NM_024790.6:c.2113+34_2113+36del
344/12023 0.01431 5 curation Benign
View 8 77619765 77619765 T > - ZFHX4 NM_024721.4:c.2591-8del
130/11958 0.00548 5 curation Benign
View 8 90982691 90982691 G > A NBN NM_002485.4:c.797C>T
NP_002476.2:p.Pro266Leu
61/14969 0.00207 1 Benign
View 8 96060796 96060797 - > T NDUFAF6 NM_152416.3:c.816+18dupT
64/11990 0.00271 5 curation Benign
View 8 100182333 100182333 G > C VPS13B VPS13B VPS13B NM_017890.4:c.2275G>C
NM_152564.4:c.2275G>C
NM_015243.2:c.2275G>C
NP_060360.3:p.Val759Leu
NP_689777.3:p.Val759Leu
NP_056058.2:p.Val759Leu
185/14969 0.00621 5 curation Benign
View 8 100520087 100520087 G > A VPS13B VPS13B NM_017890.4:c.4247G>A
NM_152564.4:c.4224+656G>A
NP_060360.3:p.Arg1416Gln
102/14969 0.00361 5 curation Benign
View 8 100654319 100654319 C > T VPS13B VPS13B NM_017890.4:c.5576C>T
NM_152564.4:c.5501C>T
NP_060360.3:p.Ser1859Leu
NP_689777.3:p.Ser1834Leu
144/14969 0.00498 5 curation Benign
View 8 106814597 106814597 G > A ZFPM2 NM_012082.3:c.2287G>A
NP_036214.2:p.Val763Ile
106/13144 0.00407 5 curation Benign
View 8 117864954 117864954 A > - RAD21 NM_006265.2:c.1162-6del
193/12016 0.00836 5 curation Benign
View 8 117868534 117868535 AA > - RAD21 NM_006265.2:c.815-6_815-5del
568/12088 0.02362 5 curation Benign
View 8 117868535 117868535 A > - RAD21 NM_006265.2:c.815-5del
227/12043 0.00996 5 curation Benign
View 8 119122313 119122316 CAGA > - EXT1 NM_000127.2:c.962+8_962+11del
133/11997 0.00567 5 curation Benign
View 8 133150129 133150129 C > T KCNQ3 KCNQ3 NM_004519.3:c.1700+3G>A
NM_001204824.1:c.1340+3G>A
115/11991 0.00484 5 curation Benign
View 8 133152311 133152311 T > C KCNQ3 KCNQ3 NM_004519.3:c.1568+12A>G
NM_001204824.1:c.1208+12A>G
5/11944 0.00021 3 five_prime_intronic Benign
View 8 141294140 141294140 T > G TRAPPC9 TRAPPC9 NM_001160372.1:c.1982-20A>C
NM_031466.5:c.2276-20A>C
145/13783 0.00533 5 curation Benign
View 8 144998620 144998620 C > T PLEC PLEC PLEC PLEC PLEC PLEC PLEC PLEC NM_201378.2:c.5435G>A
NM_201379.1:c.5411G>A
NM_000445.3:c.5558G>A
NM_201382.2:c.5477G>A
NM_201383.1:c.5489G>A
NM_201384.1:c.5477G>A
NM_201380.2:c.5888G>A
NM_201381.1:c.5381G>A
NP_958780.1:p.Arg1812Gln
NP_958781.1:p.Arg1804Gln
NP_000436.2:p.Arg1853Gln
NP_958784.1:p.Arg1826Gln
NP_958785.1:p.Arg1830Gln
NP_958786.1:p.Arg1826Gln
NP_958782.1:p.Arg1963Gln
NP_958783.1:p.Arg1794Gln
232/14969 0.00788 5 curation Benign
View 8 145582740 145582740 A > G SLC52A2 SLC52A2 SLC52A2 SLC52A2 NM_001253816.1:c.-110-104A>G
NM_001253815.1:c.-106-108A>G
NR_045600.1:n.485+15A>G
NM_024531.4:c.-110-104A>G
187/11961 0.00807 5 curation Benign
View 8 145738411 145738416 GGTGCA > - RECQL4 ENST00000428558.2:c.2569_2574del
ENSP00000475456.1:p.Cys857_Thr858del
120/13144 0.0046 5 curation Benign
View 8 145738583 145738584 GG > - RECQL4 ENST00000428558.2:c.2463+18_2463+19del
5866/12627 0.26051 5 curation Benign
Displaying 950 through 1,000 of 1,342 variants