Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 5 90016024 90016024 T > A ADGRV1 ADGRV1 NR_003149.1:n.9620T>A
NM_032119.3:c.9607T>A
NP_115495.3:p.Ser3203Thr
20/8004 0.00125 4 non_synonymous Likely Benign
View 5 90016778 90016778 C > T ADGRV1 ADGRV1 NR_003149.1:n.9663C>T
NM_032119.3:c.9650C>T
NP_115495.3:p.Ala3217Val
132/8004 0.00825 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Likely Benign
View 5 90041091 90041091 A > G ADGRV1 ADGRV1 NR_003149.1:n.10782+9A>G
NM_032119.3:c.10769+9A>G
102/8004 0.00643 3 five_prime_intronic Likely Benign
View 5 90041574 90041574 T > C ADGRV1 ADGRV1 NR_003149.1:n.10949T>C
NM_032119.3:c.10936T>C
NP_115495.3:p.Ser3646Pro
80/8004 0.005 4 non_synonymous Likely Benign
View 5 90059270 90059270 C > A ADGRV1 ADGRV1 NR_003149.1:n.12282C>A
NM_032119.3:c.12269C>A
NP_115495.3:p.Thr4090Asn
88/8004 0.0055 4 non_synonymous Likely Benign
View 5 90136800 90136800 A > G ADGRV1 ADGRV1 NR_003149.1:n.17030A>G
NM_032119.3:c.17017A>G
NP_115495.3:p.Lys5673Glu
38/8004 0.00237 4 non_synonymous Likely Benign
View 5 94842619 94842619 G > C TTC37 NM_014639.3:c.3092+19C>G
51/6174 0.00421 4 Common ExAC MAF original cat: TYPE_3 - five_prime_intronic Likely Benign
View 5 94858004 94858004 C > T TTC37 NM_014639.3:c.1765G>A
NP_055454.1:p.Ala589Thr
6/6213 0.00048 4 non_synonymous Likely Benign
View 5 94878992 94878992 C > T TTC37 NM_014639.3:c.130G>A
NP_055454.1:p.Val44Ile
51/6213 0.00418 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Likely Benign
View 5 112043492 112043492 C > A APC NM_001127511.2:c.78C>A
NP_001120983.2:p.Ser26Arg
20/6213 0.00161 4 non_synonymous Likely Benign
View 5 112173899 112173899 C > T APC APC APC NM_001127511.2:c.2554C>T
NM_001127510.2:c.2608C>T
NM_000038.5:c.2608C>T
NP_001120983.2:p.Pro852Ser
NP_001120982.1:p.Pro870Ser
NP_000029.2:p.Pro870Ser
25/6213 0.00209 4 Likely Benign
View 5 112174677 112174677 T > C APC APC APC NM_001127511.2:c.3332T>C
NM_001127510.2:c.3386T>C
NM_000038.5:c.3386T>C
NP_001120983.2:p.Leu1111Ser
NP_001120982.1:p.Leu1129Ser
NP_000029.2:p.Leu1129Ser
35/6213 0.00282 4 Likely Benign
View 5 112179153 112179153 C > G APC APC APC NM_001127511.2:c.7808C>G
NM_001127510.2:c.7862C>G
NM_000038.5:c.7862C>G
NP_001120983.2:p.Ser2603Cys
NP_001120982.1:p.Ser2621Cys
NP_000029.2:p.Ser2621Cys
44/6213 0.00362 4 Likely Benign
View 5 118850709 118850709 G > A HSD17B4 HSD17B4 HSD17B4 NM_000414.3:c.1471G>A
NM_001199292.1:c.1417G>A
NM_001199291.1:c.1546G>A
NP_000405.1:p.Ala491Thr
NP_001186221.1:p.Ala473Thr
NP_001186220.1:p.Ala516Thr
105/8004 0.00656 4 non_synonymous Likely Benign
View 5 121413205 121413205 G > T LOX NM_002317.5:c.476C>A
NP_002308.2:p.Pro159Gln
111/6213 0.00901 4 non_synonymous Likely Benign
View 5 125880710 125880710 T > C ALDH7A1 ALDH7A1 ALDH7A1 NM_001201377.1:c.1483A>G
NM_001182.4:c.1567A>G
NM_001202404.1:c.1456A>G
NP_001188306.1:p.Thr495Ala
NP_001173.2:p.Thr523Ala
NP_001189333.1:p.Thr486Ala
58/8223 0.00353 4 non_synonymous Likely Benign
View 5 125930924 125930924 C > G ALDH7A1 ALDH7A1 ALDH7A1 NM_001201377.1:c.-118G>C
NM_001182.4:c.-34G>C
NM_001202404.1:c.48G>C
NP_001189333.1:p.Gln16His
12/8223 0.00073 4 non_synonymous Likely Benign
View 5 126674930 126674930 C > G MEGF10 MEGF10 NM_032446.2:c.218+17C>G
NM_001256545.1:c.218+17C>G
50/6174 0.00413 4 five_prime_intronic Likely Benign
View 5 127614491 127614491 A > G FBN2 NM_001999.3:c.7181T>C
NP_001990.2:p.Ile2394Thr
41/6213 0.0033 4 non_synonymous Likely Benign
View 5 127668685 127668685 G > T FBN2 NM_001999.3:c.4141C>A
NP_001990.2:p.His1381Asn
53/6213 0.00427 4 Likely Benign
View 5 127702112 127702112 C > T FBN2 NM_001999.3:c.2260G>A
NP_001990.2:p.Gly754Ser
21/6214 0.00169 4 Likely Benign
View 5 127744405 127744405 C > T FBN2 NM_001999.3:c.1040G>A
NP_001990.2:p.Arg347His
64/6213 0.00523 4 non_synonymous Likely Benign
View 5 127782297 127782297 C > T FBN2 NM_001999.3:c.829G>A
NP_001990.2:p.Val277Ile
29/6213 0.00233 3 non_synonymous Likely Benign
View 5 127800515 127800515 A > G FBN2 NM_001999.3:c.728T>C
NP_001990.2:p.Ile243Thr
97/6213 0.00789 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Likely Benign
View 5 131915574 131915574 C > T RAD50 NM_005732.3:c.572C>T
NP_005723.2:p.Thr191Ile
10/6213 0.0008 3 non_synonymous Likely Benign
View 5 135364892 135364892 C > A TGFBI NM_000358.2:c.134+14C>A
34/6174 0.00275 4 five_prime_intronic Likely Benign
View 5 138282960 138282960 C > T SIL1 SIL1 NM_001037633.1:c.1232G>A
NM_022464.4:c.1232G>A
NP_001032722.1:p.Arg411His
NP_071909.1:p.Arg411His
6/8004 0.00037 4 non_synonymous Likely Benign
View 5 138378394 138378394 G > A SIL1 SIL1 NM_001037633.1:c.368C>T
NM_022464.4:c.368C>T
NP_001032722.1:p.Thr123Ile
NP_071909.1:p.Thr123Ile
128/8004 0.00806 4 non_synonymous Likely Benign
View 5 138456729 138456729 T > C SIL1 SIL1 NM_001037633.1:c.239A>G
NM_022464.4:c.239A>G
NP_001032722.1:p.Gln80Arg
NP_071909.1:p.Gln80Arg
43/8004 0.00269 4 Common ExAC MAF original cat: TYPE_3 - non_synonymous Likely Benign
View 5 138456779 138456779 A > C SIL1 SIL1 NM_001037633.1:c.189T>G
NM_022464.4:c.189T>G
NP_001032722.1:p.Asp63Glu
NP_071909.1:p.Asp63Glu
24/8004 0.0015 4 non_synonymous Likely Benign
View 5 140027129 140027129 G > C NDUFA2 NDUFA2 NDUFA2 NM_001185012.1:c.40C>G
NR_033697.1:n.242C>G
NM_002488.4:c.40C>G
NP_001171941.1:p.Leu14Val
NP_002479.1:p.Leu14Val
10/6213 0.0008 3 non_synonymous Likely Benign
View 5 140953563 140953564 - > GGAGGA DIAPH1 DIAPH1 NM_001079812.2:c.1821_1826dupTCCTCC
NM_005219.4:c.1848_1853dupTCCTCC
NP_001073280.1:p.Pro610_Pro611dup
NP_005210.3:p.Pro619_Pro620dup
96/6213 0.00789 4 in_frame_indel Likely Benign
View 5 140953566 140953567 - > GGA DIAPH1 DIAPH1 NM_001079812.2:c.1824_1826dupTCC
NM_005219.4:c.1851_1853dupTCC
NP_001073280.1:p.Pro611dup
NP_005210.3:p.Pro620dup
163/6213 0.01312 4 in_frame_indel Likely Benign
View 5 146258290 146258291 - > GCTGCTGCTGCTGCTGCTGCT PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B PPP2R2B NM_001271899.1:c.89-177606_89-177586dupAGCAGCAGCAGCAGCAGCAGC
NM_181675.3:c.37_57dupAGCAGCAGCAGCAGCAGCAGC
NR_073526.1:n.38_58dupAGCAGCAGCAGCAGCAGCAGC
NM_001271948.1:c.-795_-775dupAGCAGCAGCAGCAGCAGCAGC
NM_181677.2:c.10+156421_10+156441dupAGCAGCAGCAGCAGCAGCAGC
NM_181676.2:c.79+176917_79+176937dupAGCAGCAGCAGCAGCAGCAGC
NM_001271900.1:c.51-553_51-533dupAGCAGCAGCAGCAGCAGCAGC
NR_073527.1:n.180_200dupAGCAGCAGCAGCAGCAGCAGC
NM_181678.2:c.-48-22165_-48-22145dupAGCAGCAGCAGCAGCAGCAGC
NM_181674.2:c.75-553_75-533dupAGCAGCAGCAGCAGCAGCAGC
NP_858061.2:p.Ser13_Ser19dup
65/6213 0.00531 4 in_frame_indel Likely Benign
View 5 147207495 147207495 T > A SPINK1 NM_003122.3:c.194+90A>T
63/6175 0.00551 4 Likely Benign
View 5 147207714 147207714 T > A SPINK1 NM_003122.3:c.88-23A>T
45/6175 0.00364 4 Likely Benign
View 5 147211181 147211181 C > T SPINK1 NM_003122.3:c.-41G>A
103/6174 0.00915 4 Likely Benign
View 5 147475388 147475388 C > T SPINK5 SPINK5 SPINK5 NM_006846.3:c.802C>T
NM_001127699.1:c.802C>T
NM_001127698.1:c.802C>T
NP_006837.2:p.Arg268Cys
NP_001121171.1:p.Arg268Cys
NP_001121170.1:p.Arg268Cys
110/6213 0.00917 4 non_synonymous Likely Benign
View 5 149512407 149512407 G > A PDGFRB NM_002609.3:c.1033C>T
NP_002600.1:p.Pro345Ser
127/6213 0.01022 4 non_synonymous Likely Benign
View 5 149512494 149512494 C > T PDGFRB NM_002609.3:c.946G>A
NP_002600.1:p.Val316Met
36/6213 0.0029 4 non_synonymous Likely Benign
View 5 149751746 149751763 AGTGAGGAGGGATCTGAA > - TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 NM_001135243.1:c.827_844del
NM_000356.3:c.640-1981_640-1964del
NM_001135245.1:c.640-1981_640-1964del
NM_001008657.2:c.827_844del
NM_001195141.1:c.827_844del
NM_001135244.1:c.827_844del
NP_001128715.1:p.Gly276_Glu281del
NP_001008657.1:p.Gly276_Glu281del
NP_001182070.1:p.Gly276_Glu281del
NP_001128716.1:p.Gly276_Glu281del
36/6213 0.0029 4 Likely Benign
View 5 149753894 149753894 G > A TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 NM_001135243.1:c.1028G>A
NM_000356.3:c.797G>A
NM_001135245.1:c.797G>A
NM_001008657.2:c.1028G>A
NM_001195141.1:c.1028G>A
NM_001135244.1:c.1028G>A
NP_001128715.1:p.Ser343Asn
NP_000347.2:p.Ser266Asn
NP_001128717.1:p.Ser266Asn
NP_001008657.1:p.Ser343Asn
NP_001182070.1:p.Ser343Asn
NP_001128716.1:p.Ser343Asn
33/6213 0.00266 4 Likely Benign
View 5 149754216 149754216 G > T TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 NM_001135243.1:c.1120G>T
NM_000356.3:c.889G>T
NM_001135245.1:c.889G>T
NM_001008657.2:c.1120G>T
NM_001195141.1:c.1120G>T
NM_001135244.1:c.1120G>T
NP_001128715.1:p.Ala374Ser
NP_000347.2:p.Ala297Ser
NP_001128717.1:p.Ala297Ser
NP_001008657.1:p.Ala374Ser
NP_001182070.1:p.Ala374Ser
NP_001128716.1:p.Ala374Ser
11/6213 0.00097 4 non_synonymous Likely Benign
View 5 149754325 149754325 C > T TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 NM_001135243.1:c.1229C>T
NM_000356.3:c.998C>T
NM_001135245.1:c.998C>T
NM_001008657.2:c.1229C>T
NM_001195141.1:c.1229C>T
NM_001135244.1:c.1229C>T
NP_001128715.1:p.Ser410Leu
NP_000347.2:p.Ser333Leu
NP_001128717.1:p.Ser333Leu
NP_001008657.1:p.Ser410Leu
NP_001182070.1:p.Ser410Leu
NP_001128716.1:p.Ser410Leu
52/6213 0.00435 4 non_synonymous Likely Benign
View 5 149755712 149755712 C > T TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 TCOF1 NM_001135243.1:c.1961C>T
NM_000356.3:c.1730C>T
NM_001135245.1:c.1730C>T
NM_001008657.2:c.1961C>T
NM_001195141.1:c.1961C>T
NM_001135244.1:c.1961C>T
NP_001128715.1:p.Ala654Val
NP_000347.2:p.Ala577Val
NP_001128717.1:p.Ala577Val
NP_001008657.1:p.Ala654Val
NP_001182070.1:p.Ala654Val
NP_001128716.1:p.Ala654Val
4/6213 0.00032 4 non_synonymous Likely Benign
View 5 149922543 149922543 C > T NDST1 NM_001543.4:c.1970+10C>T
16/6213 0.00129 4 Common ExAC MAF original cat: TYPE_3 - five_prime_intronic Likely Benign
View 5 150028651 150028651 C > T SYNPO SYNPO SYNPO SYNPO NM_001109974.2:c.814C>T
NM_007286.5:c.814C>T
NM_001166209.1:c.1546C>T
NM_001166208.1:c.1546C>T
NP_001103444.1:p.Pro272Ser
NP_009217.3:p.Pro272Ser
NP_001159681.1:p.Pro516Ser
NP_001159680.1:p.Pro516Ser
85/6213 0.00684 4 Likely Benign
View 5 156184726 156184728 AGA > - SGCD SGCD SGCD NM_001128209.1:c.696+13_696+15del
NM_000337.5:c.699+13_699+15del
NM_172244.2:c.712_714del
NP_758447.1:p.Lys238del
31/6213 0.00249 4 Likely Benign
View 5 161300306 161300306 C > T GABRA1 GABRA1 GABRA1 GABRA1 GABRA1 NM_001127648.1:c.439C>T
NM_001127643.1:c.439C>T
NM_000806.5:c.439C>T
NM_001127645.1:c.439C>T
NM_001127644.1:c.439C>T
NP_001121120.1:p.Arg147Trp
NP_001121115.1:p.Arg147Trp
NP_000797.2:p.Arg147Trp
NP_001121117.1:p.Arg147Trp
NP_001121116.1:p.Arg147Trp
2/6213 0.00016 4 non_synonymous Likely Benign
View 5 161531050 161531050 A > G GABRG2 GABRG2 GABRG2 NM_198904.2:c.769+18A>G
NM_000816.3:c.769+18A>G
NM_198903.2:c.889+18A>G
2/6174 0.00016 4 five_prime_intronic Likely Benign
Displaying 1,550 through 1,600 of 2,310 variants