Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 6 152560836 152560836 G > C SYNE1 SYNE1 NM_033071.3:c.19686C>G
NM_182961.3:c.19899C>G
NP_149062.1:p.Tyr6562Ter
NP_892006.3:p.Tyr6633Ter
2/8685 0.00012 2 premature_stop Likely pathogenic
View 6 158541464 158541464 G > A SERAC1 SERAC1 NR_073096.1:n.1187C>T
NM_032861.3:c.1159C>T
NP_116250.3:p.Arg387Ter
2/8685 0.00012 2 premature_stop Likely pathogenic
View 6 170592353 170592354 CT > - DLL1 NM_005618.3:c.2013_2014del
NP_005609.3:p.Glu673GlyfsTer15
2/8685 0.00012 2 frameshift Likely pathogenic
View 7 19156522 19156523 - > TCCGAGGGCAGCGTGGGGATGATCT TWIST1 NM_000474.3:c.398_422dupAGATCATCCCCACGCTGCCCTCGGA
NP_000465.1:p.Asp141GlufsTer105
1/8685 6.0e-05 2 frameshift Likely pathogenic
View 7 44104863 44104863 T > G PGAM2 NM_000290.3:c.266A>C
NP_000281.2:p.Glu89Ala
7/8685 0.0004 1 Likely pathogenic
View 7 44189575 44189575 C > T GCK GCK GCK NM_000162.3:c.572G>A
NM_033507.1:c.575G>A
NM_033508.1:c.569G>A
NP_000153.1:p.Arg191Gln
NP_277042.1:p.Arg192Gln
NP_277043.1:p.Arg190Gln
1/8685 6.0e-05 1 Likely pathogenic
View 7 65546812 65546812 G > A ASL ASL ASL ASL NM_000048.3:c.35G>A
NM_001024943.1:c.35G>A
NM_001024944.1:c.35G>A
NM_001024946.1:c.35G>A
NP_000039.2:p.Arg12Gln
NP_001020114.1:p.Arg12Gln
NP_001020115.1:p.Arg12Gln
NP_001020117.1:p.Arg12Gln
40/10521 0.0019 2 Likely pathogenic
View 7 97483937 97483938 - > A ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.1192dupT
NM_001178077.1:c.943dupT
NM_133436.3:c.1192dupT
NM_001178075.1:c.1129dupT
NM_001178076.1:c.943dupT
NM_001673.4:c.1192dupT
NP_899199.2:p.Tyr398LeufsTer4
NP_001171548.1:p.Tyr315LeufsTer4
NP_597680.2:p.Tyr398LeufsTer4
NP_001171546.1:p.Tyr377LeufsTer4
NP_001171547.1:p.Tyr315LeufsTer4
NP_001664.3:p.Tyr398LeufsTer4
3/8685 0.00017 2 frameshift Likely pathogenic
View 7 97488213 97488213 A > G ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.728T>C
NM_001178077.1:c.479T>C
NM_133436.3:c.728T>C
NM_001178075.1:c.665T>C
NM_001178076.1:c.479T>C
NM_001673.4:c.728T>C
NP_899199.2:p.Val243Ala
NP_001171548.1:p.Val160Ala
NP_597680.2:p.Val243Ala
NP_001171546.1:p.Val222Ala
NP_001171547.1:p.Val160Ala
NP_001664.3:p.Val243Ala
3/8685 0.00017 1 non_synonymous Likely pathogenic
View 7 103234127 103234127 A > C RELN RELN NM_173054.2:c.3912+2T>G
NM_005045.3:c.3912+2T>G
1/10521 5.0e-05 2 donor_site Likely pathogenic
View 7 117149143 117149143 C > T CFTR NM_000492.3:c.220C>T
NP_000483.3:p.Arg74Trp
46/10773 0.00213 1 Likely pathogenic
View 7 117232470 117232470 C > T CFTR NM_000492.3:c.2249C>T
NP_000483.3:p.Pro750Leu
18/10773 0.00084 1 Likely pathogenic
View 7 117232473 117232473 G > T CFTR NM_000492.3:c.2252G>T
NP_000483.3:p.Arg751Leu
1/10773 5.0e-05 1 Likely pathogenic
View 7 117234999 117234999 G > T CFTR NM_000492.3:c.2506G>T
NP_000483.3:p.Asp836Tyr
13/10773 0.0006 1 Likely pathogenic
View 7 128490031 128490031 C > T FLNC FLNC ENST00000325888.8:c.5201C>T
ENST00000346177.6:c.5199+399C>T
ENSP00000327145.8:p.Ala1734Val
1/8685 6.0e-05 2 non_synonymous Likely pathogenic
View 7 151874708 151874709 - > CGTC KMT2C NM_170606.2:c.7826_7829dupGACG
NP_733751.2:p.Pro2611ThrfsTer8
1/8685 6.0e-05 2 frameshift Likely pathogenic
View 8 22031174 22031174 C > T BMP1 BMP1 BMP1 BMP1 NM_006129.4:c.208C>T
NR_033404.1:n.474C>T
NM_001199.3:c.208C>T
NR_033403.1:n.474C>T
NP_006120.1:p.Gln70Ter
NP_001190.1:p.Gln70Ter
1/8685 6.0e-05 1 premature_stop Likely pathogenic
View 8 65509264 65509264 G > A CYP7B1 NM_004820.3:c.1456C>T
NP_004811.1:p.Arg486Cys
23/8939 0.00129 1 Likely pathogenic
View 8 68089949 68089949 A > - CSPP1 NM_024790.6:c.3129del
NP_079066.5:p.Glu1044SerfsTer13
4/8685 0.00023 2 frameshift Likely pathogenic
View 8 92096343 92096343 G > A OTUD6B NM_016023.3:c.887+1G>A
2/8646 0.00012 1 ClinVar pathogenic variant Likely pathogenic
View 8 94792831 94792831 A > G TMEM67 TMEM67 TMEM67 NM_153704.5:c.725A>G
NM_001142301.1:c.482A>G
NR_024522.1:n.796A>G
NP_714915.3:p.Asn242Ser
NP_001135773.1:p.Asn161Ser
2/10521 0.0001 1 Likely pathogenic
View 8 97172848 97172848 G > A GDF6 NM_001001557.2:c.73C>T
NP_001001557.1:p.Gln25Ter
1/8685 6.0e-05 1 Likely pathogenic
View 8 116631538 116631538 G > - TRPS1 NM_014112.2:c.787del
NP_054831.2:p.Leu263CysfsTer53
1/8685 6.0e-05 2 frameshift Likely pathogenic
View 8 140922501 140922501 C > A TRAPPC9 TRAPPC9 NM_001160372.1:c.2854G>T
NM_031466.5:c.3148G>T
NP_001153844.1:p.Glu952Ter
NP_113654.4:p.Glu1050Ter
2/10521 0.0001 2 premature_stop Likely pathogenic
View 8 141468493 141468493 C > - TRAPPC9 NM_031466.5:c.171del
NP_113654.4:p.Tyr58ThrfsTer22
5/10521 0.00024 2 frameshift Likely pathogenic
View 8 145736918 145736918 G > A RECQL4 ENST00000428558.2:c.3523C>T
ENSP00000475456.1:p.Gln1175Ter
2/8685 0.00012 1 Likely pathogenic
View 9 79975555 79975555 G > T VPS13A VPS13A VPS13A VPS13A NM_033305.2:c.8209G>T
NM_015186.3:c.8209G>T
NM_001018038.2:c.8209G>T
NM_001018037.1:c.8092G>T
NP_150648.2:p.Glu2737Ter
NP_056001.1:p.Glu2737Ter
NP_001018048.1:p.Glu2737Ter
NP_001018047.1:p.Glu2698Ter
1/8685 6.0e-05 2 premature_stop Likely pathogenic
View 9 95030504 95030505 TC > - IARS IARS IARS NM_013417.3:c.1382_1383del
NM_002161.5:c.1382_1383del
NR_073446.1:n.1378_1379del
NP_038203.2:p.Arg461IlefsTer13
NP_002152.2:p.Arg461IlefsTer13
2/8646 0.00012 2 frameshift Likely pathogenic
View 9 97912356 97912356 G > A FANCC FANCC FANCC NM_001243744.1:c.535C>T
NM_001243743.1:c.535C>T
NM_000136.2:c.535C>T
NP_001230673.1:p.Arg179Ter
NP_001230672.1:p.Arg179Ter
NP_000127.2:p.Arg179Ter
2/10521 0.0001 1 Likely pathogenic
View 9 99017189 99017189 G > A HSD17B3 NM_000197.1:c.238C>T
NP_000188.1:p.Arg80Trp
1/10521 0.0001 1 Likely pathogenic
View 9 130422322 130422322 T > A STXBP1 STXBP1 NM_001032221.3:c.260T>A
NM_003165.3:c.260T>A
NP_001027392.1:p.Leu87His
NP_003156.1:p.Leu87His
1/8685 6.0e-05 2 non_synonymous Likely pathogenic
View 9 130442468 130442469 - > TA STXBP1 STXBP1 NM_001032221.3:c.1495_1496dupTA
NM_003165.3:c.1495_1496dupTA
NP_001027392.1:p.Pro500ThrfsTer47
NP_003156.1:p.Pro500ThrfsTer47
1/8685 6.0e-05 2 frameshift Likely pathogenic
View 9 134398318 134398320 GGT > - POMT1 POMT1 POMT1 POMT1 POMT1 ENST00000402686.3:c.2004-1_2005del
ENST00000341012.7:c.1842-1_1843del
ENST00000372228.3:c.2070-1_2071del
ENST00000404875.2:c.1653-1_1654del
ENST00000423007.1:c.2004-1_2005del
1/10521 5.0e-05 2 disruption_of_splicing Likely pathogenic
View 9 136223295 136223311 CGCAGCCCCAGCTGCAA > - SURF1 SURF1 NM_001280787.1:c.-257_-241del
NM_003172.3:c.19_35del
NP_003163.1:p.Leu7GlyfsTer47
2/10521 0.0001 1 Likely pathogenic
View 9 139090593 139090594 - > A LHX3 LHX3 NM_014564.3:c.694dupT
NM_178138.4:c.679dupT
NP_055379.1:p.Tyr232LeufsTer28
NP_835258.1:p.Tyr227LeufsTer28
2/10521 0.0001 2 frameshift Likely pathogenic
View 9 139412682 139412682 C > T NOTCH1 NM_017617.3:c.1162G>A
NP_060087.3:p.Asp388Asn
1/8685 6.0e-05 2 non_synonymous Likely pathogenic
View 9 140057186 140057186 C > A GRIN1 GRIN1 GRIN1 GRIN1 GRIN1 NM_001185091.1:c.2071C>A
NM_001185090.1:c.2071C>A
NM_021569.3:c.2008C>A
NM_007327.3:c.2008C>A
NM_000832.6:c.2008C>A
NP_001172020.1:p.Pro691Thr
NP_001172019.1:p.Pro691Thr
NP_067544.1:p.Pro670Thr
NP_015566.1:p.Pro670Thr
NP_000823.4:p.Pro670Thr
1/8685 6.0e-05 1 non_synonymous Likely pathogenic
View X 19377698 19377698 A > C PDHA1 PDHA1 PDHA1 PDHA1 NM_000284.3:c.1100A>C
NM_001173456.1:c.1007A>C
NM_001173455.1:c.1121A>C
NM_001173454.1:c.1214A>C
NP_000275.1:p.His367Pro
NP_001166927.1:p.His336Pro
NP_001166926.1:p.His374Pro
NP_001166925.1:p.His405Pro
1/10521 5.0e-05 1 non_synonymous Likely pathogenic
View X 21761900 21761901 - > G SMPX SMPX NM_014332.2:c.99dupC
NR_045617.1:n.330dupC
NP_055147.1:p.Arg34GlnfsTer8
1/8685 0.00012 2 frameshift Likely pathogenic
View X 22002513 22002513 C > T SMS SMS NM_001258423.1:c.683C>T
NM_004595.4:c.842C>T
NP_001245352.1:p.Pro228Leu
NP_004586.2:p.Pro281Leu
1/10521 0.0001 1 non_synonymous Likely pathogenic
View X 41200785 41200786 - > TGCG DDX3X DDX3X DDX3X NM_001193416.1:c.202_205dupGCGT
NM_001193417.1:c.154_157dupGCGT
NM_001356.3:c.202_205dupGCGT
NP_001180345.1:p.Tyr69CysfsTer3
NP_001180346.1:p.Tyr53CysfsTer3
NP_001347.3:p.Tyr69CysfsTer3
1/8685 6.0e-05 2 frameshift Likely pathogenic
View X 41481869 41481869 C > T CASK CASK CASK NM_003688.3:c.1033+1G>A
NM_001126054.2:c.1033+1G>A
NM_001126055.2:c.1015+3988G>A
2/10521 0.00014 2 donor_site Likely pathogenic
View X 47041660 47041667 ACAGGGGC > - RBM10 RBM10 RBM10 RBM10 RBM10 NM_152856.2:c.1653_1660del
NM_001204466.1:c.1656_1663del
NM_001204467.1:c.1884_1891del
NM_001204468.1:c.2082_2089del
NM_005676.4:c.1887_1894del
NP_690595.1:p.Gly552LeufsTer40
NP_001191395.1:p.Gly553LeufsTer40
NP_001191396.1:p.Gly629LeufsTer40
NP_001191397.1:p.Gly695LeufsTer40
NP_005667.2:p.Gly630LeufsTer40
2/8685 0.00017 2 frameshift Likely pathogenic
View X 49082533 49082533 T > C CACNA1F CACNA1F CACNA1F NM_005183.2:c.1524-2A>G
NM_001256790.1:c.1329-2A>G
NM_001256789.1:c.1491-2A>G
2/8685 0.00017 2 acceptor_site Likely pathogenic
View X 53250025 53250025 A > G KDM5C KDM5C NM_001146702.1:c.151-2877T>C
NM_004187.3:c.224T>C
NP_004178.2:p.Leu75Pro
1/10521 5.0e-05 1 non_synonymous Likely pathogenic
View X 64141723 64141723 G > A ZC4H2 ZC4H2 ZC4H2 ZC4H2 ZC4H2 NM_001243804.1:c.130C>T
NM_001178032.2:c.130C>T
NM_001178033.2:c.199C>T
NM_018684.3:c.199C>T
NR_045044.1:n.610C>T
NP_001230733.1:p.Arg44Ter
NP_001171503.1:p.Arg44Ter
NP_001171504.1:p.Arg67Ter
NP_061154.1:p.Arg67Ter
1/8685 6.0e-05 1 ClinVar pathogenic variant Likely pathogenic
View X 66941751 66941751 C > G AR AR NM_000044.3:c.2395C>G
NM_001011645.2:c.799C>G
NP_000035.2:p.Gln799Glu
NP_001011645.1:p.Gln267Glu
15/10521 0.0009 1 Likely pathogenic
View X 71787760 71787760 C > G HDAC8 HDAC8 HDAC8 HDAC8 HDAC8 HDAC8 HDAC8 NM_001166418.1:c.164+4147G>C
NM_001166419.1:c.416G>C
NM_018486.2:c.416G>C
NM_001166448.1:c.164+4147G>C
NM_001166420.1:c.416G>C
NM_001166422.1:c.416G>C
NR_051952.1:n.637+844G>C
NP_001159891.1:p.Gly139Ala
NP_060956.1:p.Gly139Ala
NP_001159892.1:p.Gly139Ala
NP_001159894.1:p.Gly139Ala
1/8685 6.0e-05 1 non_synonymous Likely pathogenic
View X 73744462 73744462 C > G SLC16A2 NM_006517.4:c.844C>G
NP_006508.2:p.Pro282Ala
1/10521 0.0001 3 non_synonymous Likely pathogenic
View X 79945476 79945476 G > A BRWD3 ENST00000373275.4:c.3718C>T
ENSP00000362372.4:p.Arg1240Ter
1/10521 0.0001 1 premature_stop Likely pathogenic
Displaying 250 through 300 of 307 variants