Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 5 6633024 6633024 G > - NSUN2 NSUN2 NSUN2 NR_037947.1:n.450del
NM_017755.5:c.69del
NM_001193455.1:c.69del
NP_060225.4:p.Glu24ArgfsTer55
NP_001180384.1:p.Glu24ArgfsTer55
1/11422 4.0e-05 2 frameshift Likely pathogenic
View 5 37180188 37180189 CA > - CPLANE1 NM_023073.3:c.5667_5668del
NP_075561.3:p.Asp1890Ter
2/9594 0.0001 2 frameshift Likely pathogenic
View 5 37201863 37201863 C > A CPLANE1 NM_023073.3:c.3337G>T
NP_075561.3:p.Glu1113Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 5 68805008 68805008 G > T OCLN OCLN OCLN NM_001205254.1:c.91G>T
NM_001205255.1:c.-24-4767G>T
NM_002538.3:c.91G>T
NP_001192183.1:p.Gly31Ter
NP_002529.1:p.Gly31Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 5 90149131 90149131 T > G ADGRV1 ADGRV1 NM_032119.3:c.17235T>G
NR_003149.1:n.17248T>G
NP_115495.3:p.Tyr5745Ter
4/11422 0.00018 2 premature_stop Likely pathogenic
View 5 98223881 98223881 G > A CHD1 NM_001270.2:c.2407C>T
NP_001261.2:p.Arg803Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 5 137762924 137762924 C > T KDM3B ENST00000314358.5:c.4549C>T
ENSP00000326563.5:p.Arg1517Ter
1/9555 5.0e-05 2 premature_stop Likely pathogenic
View 5 140025247 140025247 C > - NDUFA2 NDUFA2 NDUFA2 NR_033697.1:n.547del
NM_001185012.1:c.*41del
NM_002488.4:c.225del
NP_002479.1:p.Asn76MetfsTer4
2/9594 0.0001 1 Likely pathogenic
View 5 140954700 140954700 A > - DIAPH1 DIAPH1 NM_001079812.2:c.1448del
NM_005219.4:c.1475del
NP_001073280.1:p.Leu483Ter
NP_005210.3:p.Leu492Ter
2/9594 0.0001 2 frameshift Likely pathogenic
View 5 145562053 145562053 C > - LARS NM_020117.9:c.4del
NP_064502.9:p.Ala2ArgfsTer12
2/9594 0.0001 2 frameshift Likely pathogenic
View 5 151239449 151239449 C > T GLRA1 GLRA1 NM_000171.3:c.373G>A
NM_001146040.1:c.373G>A
NP_000162.2:p.Asp125Asn
NP_001139512.1:p.Asp125Asn
2/9594 0.0001 2 non_synonymous Likely pathogenic
View 5 156752534 156752534 G > A CYFIP2 CYFIP2 CYFIP2 NM_001037332.2:c.1870G>A
NM_001037333.1:c.1870G>A
NM_014376.2:c.1870G>A
NP_001032409.2:p.Glu624Lys
NP_001032410.1:p.Glu624Lys
NP_055191.2:p.Glu624Lys
1/9555 5.0e-05 2 non_synonymous Likely pathogenic
View 5 176684104 176684104 T > A NSD1 NSD1 NM_172349.2:c.4111T>A
NM_022455.4:c.4918T>A
NP_758859.1:p.Cys1371Ser
NP_071900.2:p.Cys1640Ser
1/10293 5.0e-05 2 non_synonymous Likely pathogenic
View 6 7580621 7580621 C > T DSP DSP ENST00000379802.3:c.4198C>T
ENST00000418664.2:c.3582+616C>T
ENSP00000369129.3:p.Arg1400Ter
2/11422 9.0e-05 1 Likely pathogenic
View 6 30691372 30691372 C > G TUBB NM_178014.2:c.533C>G
NP_821133.1:p.Thr178Ser
1/9594 5.0e-05 1 non_synonymous Likely pathogenic
View 6 42935188 42935188 C > T PEX6 NM_000287.3:c.1802G>A
NP_000278.3:p.Arg601Gln
59/9594 0.00307 2 Likely pathogenic
View 6 42937486 42937486 G > - PEX6 NM_000287.3:c.1287del
NP_000278.3:p.Trp430GlyfsTer20
2/9594 0.0001 2 frameshift Likely pathogenic
View 6 73751701 73751701 C > T KCNQ5 KCNQ5 KCNQ5 KCNQ5 KCNQ5 NM_001160130.1:c.532C>T
NM_019842.3:c.532C>T
NM_001160132.1:c.532C>T
NM_001160134.1:c.532C>T
NM_001160133.1:c.532C>T
NP_001153602.1:p.Arg178Ter
NP_062816.2:p.Arg178Ter
NP_001153604.1:p.Arg178Ter
NP_001153606.1:p.Arg178Ter
NP_001153605.1:p.Arg178Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 6 74191826 74191826 C > T MTO1 MTO1 MTO1 NM_133645.2:c.1399C>T
NM_001123226.1:c.1444C>T
NM_012123.3:c.1324C>T
NP_598400.1:p.Arg467Ter
NP_001116698.1:p.Arg482Ter
NP_036255.2:p.Arg442Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 6 74191932 74191932 G > A MTO1 MTO1 MTO1 NM_133645.2:c.1505G>A
NM_001123226.1:c.1550G>A
NM_012123.3:c.1430G>A
NP_598400.1:p.Arg502His
NP_001116698.1:p.Arg517His
NP_036255.2:p.Arg477His
2/9594 0.0001 1 Likely pathogenic
View 6 86246509 86246509 C > G SNX14 SNX14 NM_153816.3:c.1608+1G>C
NM_020468.3:c.1449+1G>C
5/9594 0.00026 2 donor_site Likely pathogenic
View 6 99323430 99323447 GCTGCTCTGCAGAGTTGG > - FBXL4 FBXL4 FBXL4 NM_012160.4:c.1546_1563del
NR_103836.1:n.1591_1608del
NM_001278716.1:c.1546_1563del
NP_036292.2:p.Pro516_Ser521del
NP_001265645.1:p.Pro516_Ser521del
2/9594 0.0001 1 Likely pathogenic
View 6 99323549 99323549 G > A FBXL4 FBXL4 FBXL4 NM_012160.4:c.1444C>T
NR_103836.1:n.1489C>T
NM_001278716.1:c.1444C>T
NP_036292.2:p.Arg482Trp
NP_001265645.1:p.Arg482Trp
3/9594 0.00016 1 Likely pathogenic
View 6 99323552 99323553 - > T FBXL4 FBXL4 FBXL4 NM_012160.4:c.1440dupA
NR_103836.1:n.1485dupA
NM_001278716.1:c.1440dupA
NP_036292.2:p.Leu481ThrfsTer10
NP_001265645.1:p.Leu481ThrfsTer10
2/9594 0.0001 2 frameshift Likely pathogenic
View 6 105564658 105564661 AAGA > - BVES BVES BVES NM_001199563.1:c.731_734del
NM_147147.3:c.731_734del
NM_007073.4:c.731_734del
NP_001186492.1:p.Phe244CysfsTer20
NP_671488.1:p.Phe244CysfsTer20
NP_009004.2:p.Phe244CysfsTer20
1/9594 5.0e-05 2 frameshift Likely pathogenic
View 6 121768709 121768709 G > A GJA1 NM_000165.3:c.716G>A
NP_000156.1:p.Arg239Gln
1/9594 5.0e-05 1 Likely pathogenic
View 6 131923522 131923522 C > T MED23 MED23 MED23 MED23 NM_004830.3:c.1932-1G>A
NM_001270521.1:c.1932-1G>A
NM_001270522.1:c.1932-1G>A
NM_015979.3:c.1950-1G>A
2/9594 0.0001 2 acceptor_site Likely pathogenic
View 6 132211480 132211480 G > A ENPP1 NM_006208.2:c.2608-1G>A
1/11422 4.0e-05 2 acceptor_site Likely pathogenic
View 6 149718772 149718772 C > T TAB2 NM_015093.4:c.1636C>T
NP_055908.1:p.Arg546Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 6 152560836 152560836 G > C SYNE1 SYNE1 NM_033071.3:c.19686C>G
NM_182961.3:c.19899C>G
NP_149062.1:p.Tyr6562Ter
NP_892006.3:p.Tyr6633Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 6 158541464 158541464 G > A SERAC1 SERAC1 NR_073096.1:n.1187C>T
NM_032861.3:c.1159C>T
NP_116250.3:p.Arg387Ter
2/9594 0.0001 2 premature_stop Likely pathogenic
View 6 170592353 170592354 CT > - DLL1 NM_005618.3:c.2013_2014del
NP_005609.3:p.Glu673GlyfsTer15
2/9594 0.0001 2 frameshift Likely pathogenic
View 7 4830100 4830101 TC > - AP5Z1 NM_014855.2:c.1818_1819del
NP_055670.1:p.Gln607ValfsTer155
1/9594 5.0e-05 2 frameshift Likely pathogenic
View 7 19156522 19156523 - > TCCGAGGGCAGCGTGGGGATGATCT TWIST1 NM_000474.3:c.398_422dupAGATCATCCCCACGCTGCCCTCGGA
NP_000465.1:p.Asp141GlufsTer105
1/9594 5.0e-05 2 frameshift Likely pathogenic
View 7 44104863 44104863 T > G PGAM2 NM_000290.3:c.266A>C
NP_000281.2:p.Glu89Ala
7/9594 0.00036 1 Likely pathogenic
View 7 44189575 44189575 C > T GCK GCK GCK NM_000162.3:c.572G>A
NM_033507.1:c.575G>A
NM_033508.1:c.569G>A
NP_000153.1:p.Arg191Gln
NP_277042.1:p.Arg192Gln
NP_277043.1:p.Arg190Gln
1/9594 5.0e-05 1 Likely pathogenic
View 7 65546812 65546812 G > A ASL ASL ASL ASL NM_000048.3:c.35G>A
NM_001024943.1:c.35G>A
NM_001024944.1:c.35G>A
NM_001024946.1:c.35G>A
NP_000039.2:p.Arg12Gln
NP_001020114.1:p.Arg12Gln
NP_001020115.1:p.Arg12Gln
NP_001020117.1:p.Arg12Gln
46/11422 0.00201 2 Likely pathogenic
View 7 65552767 65552767 G > T ASL ASL ASL ASL NM_000048.3:c.707G>T
NM_001024943.1:c.707G>T
NM_001024944.1:c.707G>T
NM_001024946.1:c.629G>T
NP_000039.2:p.Arg236Leu
NP_001020114.1:p.Arg236Leu
NP_001020115.1:p.Arg236Leu
NP_001020117.1:p.Arg210Leu
2/11422 9.0e-05 2 Likely pathogenic
View 7 97483937 97483938 - > A ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.1192dupT
NM_001178077.1:c.943dupT
NM_133436.3:c.1192dupT
NM_001178075.1:c.1129dupT
NM_001178076.1:c.943dupT
NM_001673.4:c.1192dupT
NP_899199.2:p.Tyr398LeufsTer4
NP_001171548.1:p.Tyr315LeufsTer4
NP_597680.2:p.Tyr398LeufsTer4
NP_001171546.1:p.Tyr377LeufsTer4
NP_001171547.1:p.Tyr315LeufsTer4
NP_001664.3:p.Tyr398LeufsTer4
3/9594 0.00016 2 frameshift Likely pathogenic
View 7 97488213 97488213 A > G ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.728T>C
NM_001178077.1:c.479T>C
NM_133436.3:c.728T>C
NM_001178075.1:c.665T>C
NM_001178076.1:c.479T>C
NM_001673.4:c.728T>C
NP_899199.2:p.Val243Ala
NP_001171548.1:p.Val160Ala
NP_597680.2:p.Val243Ala
NP_001171546.1:p.Val222Ala
NP_001171547.1:p.Val160Ala
NP_001664.3:p.Val243Ala
3/9594 0.00016 1 non_synonymous Likely pathogenic
View 7 103234127 103234127 A > C RELN RELN NM_173054.2:c.3912+2T>G
NM_005045.3:c.3912+2T>G
1/11422 4.0e-05 2 donor_site Likely pathogenic
View 7 107412534 107412535 - > TGA SLC26A3 NM_000111.2:c.2024_2026dupTCA
NP_000102.1:p.Ile675dup
3/9594 0.00016 1 Likely pathogenic
View 7 117149143 117149143 C > T CFTR NM_000492.3:c.220C>T
NP_000483.3:p.Arg74Trp
50/11765 0.00212 1 Likely pathogenic
View 7 117232470 117232470 C > T CFTR NM_000492.3:c.2249C>T
NP_000483.3:p.Pro750Leu
19/11765 0.00081 1 Likely pathogenic
View 7 117232473 117232473 G > T CFTR NM_000492.3:c.2252G>T
NP_000483.3:p.Arg751Leu
1/11765 4.0e-05 1 Likely pathogenic
View 7 117234999 117234999 G > T CFTR NM_000492.3:c.2506G>T
NP_000483.3:p.Asp836Tyr
14/11765 0.00059 1 Likely pathogenic
View 7 128490031 128490031 C > T FLNC FLNC ENST00000325888.8:c.5201C>T
ENST00000346177.6:c.5199+399C>T
ENSP00000327145.8:p.Ala1734Val
1/9594 5.0e-05 2 non_synonymous Likely pathogenic
View 7 151874708 151874709 - > CGTC KMT2C NM_170606.2:c.7826_7829dupGACG
NP_733751.2:p.Pro2611ThrfsTer8
1/9594 5.0e-05 2 frameshift Likely pathogenic
View 7 151921249 151921250 - > CTGCACCAAACACACCTGAAATCCAAATCCCCCCGAAAAGTCTCAATTTTATTTTCTTAGTTACTCAGTTACTGTAATTCAGGAAG KMT2C NM_170606.2:c.3159-71_3173dupCTTCCTGAATTACAGTAACTGAGTAACTAAGAAAATAAAATTGAGACTTTTCGGGGGGATTTGGATTTCAGGTGTGTTTGGTGCAG
NP_733751.2:p.Arg1058SerfsTer8
1/9594 5.0e-05 2 premature_stop Likely pathogenic
View 8 22031174 22031174 C > T BMP1 BMP1 BMP1 BMP1 NM_006129.4:c.208C>T
NR_033404.1:n.474C>T
NM_001199.3:c.208C>T
NR_033403.1:n.474C>T
NP_006120.1:p.Gln70Ter
NP_001190.1:p.Gln70Ter
1/9594 5.0e-05 1 premature_stop Likely pathogenic
Displaying 250 through 300 of 344 variants