Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 6 131923522 131923522 C > T MED23 MED23 MED23 MED23 NM_004830.3:c.1932-1G>A
NM_001270521.1:c.1932-1G>A
NM_001270522.1:c.1932-1G>A
NM_015979.3:c.1950-1G>A
4/11983 0.00017 2 acceptor_site Likely pathogenic
View 6 132211480 132211480 G > A ENPP1 NM_006208.2:c.2608-1G>A
1/13810 4.0e-05 2 acceptor_site Likely pathogenic
View 6 149718772 149718772 C > T TAB2 NM_015093.4:c.1636C>T
NP_055908.1:p.Arg546Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 6 152560836 152560836 G > C SYNE1 SYNE1 NM_033071.3:c.19686C>G
NM_182961.3:c.19899C>G
NP_149062.1:p.Tyr6562Ter
NP_892006.3:p.Tyr6633Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 6 157454160 157454160 A > C ARID1B ARID1B NM_017519.2:c.2333-2A>C
NM_020732.3:c.2372-2A>C
3/11985 0.00013 2 acceptor_site Likely pathogenic
View 6 158537225 158537225 C > G SERAC1 SERAC1 NR_073096.1:n.1426G>C
NM_032861.3:c.1493G>C
NP_116250.3:p.Ser498Thr
1/13144 4.0e-05 2 Likely pathogenic
View 6 158541464 158541464 G > A SERAC1 SERAC1 NR_073096.1:n.1187C>T
NM_032861.3:c.1159C>T
NP_116250.3:p.Arg387Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 6 170592353 170592354 CT > - DLL1 NM_005618.3:c.2013_2014del
NP_005609.3:p.Glu673GlyfsTer15
4/13144 0.00015 2 frameshift Likely pathogenic
View 7 4830100 4830101 TC > - AP5Z1 NM_014855.2:c.1818_1819del
NP_055670.1:p.Gln607ValfsTer155
1/13144 4.0e-05 2 frameshift Likely pathogenic
View 7 19156522 19156523 - > TCCGAGGGCAGCGTGGGGATGATCT TWIST1 NM_000474.3:c.398_422dupAGATCATCCCCACGCTGCCCTCGGA
NP_000465.1:p.Asp141GlufsTer105
1/13144 4.0e-05 2 frameshift Likely pathogenic
View 7 42017236 42017236 C > T GLI3 NM_000168.5:c.1733G>A
NP_000159.3:p.Cys578Tyr
1/13144 4.0e-05 1 Likely pathogenic
View 7 44104863 44104863 T > G PGAM2 NM_000290.3:c.266A>C
NP_000281.2:p.Glu89Ala
7/13144 0.00027 1 Likely pathogenic
View 7 65546812 65546812 G > A ASL ASL ASL ASL NM_000048.3:c.35G>A
NM_001024943.1:c.35G>A
NM_001024944.1:c.35G>A
NM_001024946.1:c.35G>A
NP_000039.2:p.Arg12Gln
NP_001020114.1:p.Arg12Gln
NP_001020115.1:p.Arg12Gln
NP_001020117.1:p.Arg12Gln
55/14969 0.00184 2 curation Likely pathogenic
View 7 65552767 65552767 G > T ASL ASL ASL ASL NM_000048.3:c.707G>T
NM_001024943.1:c.707G>T
NM_001024944.1:c.707G>T
NM_001024946.1:c.629G>T
NP_000039.2:p.Arg236Leu
NP_001020114.1:p.Arg236Leu
NP_001020115.1:p.Arg236Leu
NP_001020117.1:p.Arg210Leu
2/14969 7.0e-05 2 curation Likely pathogenic
View 7 94037672 94037672 G > - COL1A2 NM_000089.3:c.718del
NP_000080.2:p.Val240TrpfsTer159
1/13843 4.0e-05 2 frameshift Likely pathogenic
View 7 94230171 94230171 T > C SGCE SGCE SGCE NM_001099401.1:c.826-2A>G
NM_001099400.1:c.826-2A>G
NM_003919.2:c.826-2A>G
2/11985 8.0e-05 1 ClinVar pathogenic variant Likely pathogenic
View 7 97483937 97483938 - > A ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.1192dupT
NM_001178077.1:c.943dupT
NM_133436.3:c.1192dupT
NM_001178075.1:c.1129dupT
NM_001178076.1:c.943dupT
NM_001673.4:c.1192dupT
NP_899199.2:p.Tyr398LeufsTer4
NP_001171548.1:p.Tyr315LeufsTer4
NP_597680.2:p.Tyr398LeufsTer4
NP_001171546.1:p.Tyr377LeufsTer4
NP_001171547.1:p.Tyr315LeufsTer4
NP_001664.3:p.Tyr398LeufsTer4
3/13144 0.00011 2 frameshift Likely pathogenic
View 7 97488213 97488213 A > G ASNS ASNS ASNS ASNS ASNS ASNS NM_183356.3:c.728T>C
NM_001178077.1:c.479T>C
NM_133436.3:c.728T>C
NM_001178075.1:c.665T>C
NM_001178076.1:c.479T>C
NM_001673.4:c.728T>C
NP_899199.2:p.Val243Ala
NP_001171548.1:p.Val160Ala
NP_597680.2:p.Val243Ala
NP_001171546.1:p.Val222Ala
NP_001171547.1:p.Val160Ala
NP_001664.3:p.Val243Ala
4/13144 0.00015 1 curation Likely pathogenic
View 7 100246353 100246353 T > G ACTL6B NM_016188.4:c.561A>C
NP_057272.1:p.Gln187His
1/13105 4.0e-05 2 non_synonymous Likely pathogenic
View 7 103234127 103234127 A > C RELN RELN NM_173054.2:c.3912+2T>G
NM_005045.3:c.3912+2T>G
1/13810 4.0e-05 2 donor_site Likely pathogenic
View 7 107412534 107412535 - > TGA SLC26A3 NM_000111.2:c.2024_2026dupTCA
NP_000102.1:p.Ile675dup
3/13144 0.00011 1 Likely pathogenic
View 7 117149143 117149143 C > T CFTR NM_000492.3:c.220C>T
NP_000483.3:p.Arg74Trp
63/15408 0.00204 1 Likely pathogenic
View 7 117232470 117232470 C > T CFTR NM_000492.3:c.2249C>T
NP_000483.3:p.Pro750Leu
24/15408 0.00078 1 Likely pathogenic
View 7 117232473 117232473 G > T CFTR NM_000492.3:c.2252G>T
NP_000483.3:p.Arg751Leu
1/15408 3.0e-05 1 Likely pathogenic
View 7 128490031 128490031 C > T FLNC FLNC ENST00000325888.8:c.5201C>T
ENST00000346177.6:c.5199+399C>T
ENSP00000327145.8:p.Ala1734Val
1/13144 4.0e-05 2 curation Likely pathogenic
View 7 148525867 148525868 TC > - EZH2 EZH2 EZH2 EZH2 EZH2 NM_152998.2:c.472_473del
NM_001203249.1:c.562_563del
NM_004456.4:c.589_590del
NM_001203247.1:c.589_590del
NM_001203248.1:c.562_563del
NP_694543.1:p.Glu158ArgfsTer12
NP_001190178.1:p.Glu188ArgfsTer12
NP_004447.2:p.Glu197ArgfsTer12
NP_001190176.1:p.Glu197ArgfsTer12
NP_001190177.1:p.Glu188ArgfsTer12
1/13144 4.0e-05 2 frameshift Likely pathogenic
View 7 151874708 151874709 - > CGTC KMT2C NM_170606.2:c.7826_7829dupGACG
NP_733751.2:p.Pro2611ThrfsTer8
1/13144 4.0e-05 2 frameshift Likely pathogenic
View 7 151921249 151921250 - > CTGCACCAAACACACCTGAAATCCAAATCCCCCCGAAAAGTCTCAATTTTATTTTCTTAGTTACTCAGTTACTGTAATTCAGGAAG KMT2C NM_170606.2:c.3159-71_3173dupCTTCCTGAATTACAGTAACTGAGTAACTAAGAAAATAAAATTGAGACTTTTCGGGGGGATTTGGATTTCAGGTGTGTTTGGTGCAG
NP_733751.2:p.Arg1058SerfsTer8
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 8 22031174 22031174 C > T BMP1 BMP1 BMP1 BMP1 NM_006129.4:c.208C>T
NR_033404.1:n.474C>T
NM_001199.3:c.208C>T
NR_033403.1:n.474C>T
NP_006120.1:p.Gln70Ter
NP_001190.1:p.Gln70Ter
1/13144 4.0e-05 1 curation Likely pathogenic
View 8 27634376 27634376 C > G ESCO2 NM_001017420.2:c.551C>G
NP_001017420.1:p.Ser184Ter
6/14969 0.0002 2 premature_stop Likely pathogenic
View 8 33364816 33364816 A > T TTI2 TTI2 TTI2 NM_025115.3:c.858T>A
NM_001102401.2:c.858T>A
NM_001265581.1:c.858T>A
NP_079391.2:p.Tyr286Ter
NP_001095871.1:p.Tyr286Ter
NP_001252510.1:p.Tyr286Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 8 65509264 65509264 G > A CYP7B1 NM_004820.3:c.1456C>T
NP_004811.1:p.Arg486Cys
35/13585 0.00129 1 Likely pathogenic
View 8 68089949 68089949 A > - CSPP1 NM_024790.6:c.3129del
NP_079066.5:p.Glu1044SerfsTer13
4/13144 0.00015 2 frameshift Likely pathogenic
View 8 77767737 77767737 C > A ZFHX4 NM_024721.4:c.8580C>A
NP_078997.4:p.Cys2860Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 8 92096343 92096343 G > A OTUD6B NM_016023.3:c.887+1G>A
2/11944 8.0e-05 1 ClinVar pathogenic variant Likely pathogenic
View 8 94792831 94792831 A > G TMEM67 TMEM67 TMEM67 NM_153704.5:c.725A>G
NM_001142301.1:c.482A>G
NR_024522.1:n.796A>G
NP_714915.3:p.Asn242Ser
NP_001135773.1:p.Asn161Ser
2/14969 7.0e-05 1 Likely pathogenic
View 8 97172848 97172848 G > A GDF6 NM_001001557.2:c.73C>T
NP_001001557.1:p.Gln25Ter
1/13144 4.0e-05 1 Likely pathogenic
View 8 103237239 103237239 C > T RRM2B RRM2B RRM2B NM_015713.4:c.329G>A
NM_001172478.1:c.173G>A
NM_001172477.1:c.545G>A
NP_056528.2:p.Arg110His
NP_001165949.1:p.Arg58His
NP_001165948.1:p.Arg182His
2/14969 7.0e-05 1 Likely pathogenic
View 8 116631538 116631538 G > - TRPS1 NM_014112.2:c.787del
NP_054831.2:p.Leu263CysfsTer53
1/13144 4.0e-05 1 Likely pathogenic
View 8 120795767 120795768 CA > - TAF2 ENST00000378164.2:c.1965_1966del
ENSP00000367406.2:p.Tyr655Ter
2/13144 8.0e-05 2 premature_stop Likely pathogenic
View 8 133146545 133146545 T > - KCNQ3 KCNQ3 NM_004519.3:c.1791del
NM_001204824.1:c.1431del
NP_004510.1:p.Gln597HisfsTer9
NP_001191753.1:p.Gln477HisfsTer9
2/13144 8.0e-05 2 frameshift Likely pathogenic
View 8 140922501 140922501 C > A TRAPPC9 TRAPPC9 NM_001160372.1:c.2854G>T
NM_031466.5:c.3148G>T
NP_001153844.1:p.Glu952Ter
NP_113654.4:p.Glu1050Ter
3/14969 0.0001 2 premature_stop Likely pathogenic
View 8 141461106 141461106 C > A TRAPPC9 TRAPPC9 NM_001160372.1:c.367G>T
NM_031466.5:c.661G>T
NP_001153844.1:p.Glu123Ter
NP_113654.4:p.Glu221Ter
2/14969 7.0e-05 1 ClinVar pathogenic variant Likely pathogenic
View 8 141468493 141468493 C > - TRAPPC9 NM_031466.5:c.171del
NP_113654.4:p.Tyr58ThrfsTer22
5/14969 0.00017 2 frameshift Likely pathogenic
View 8 143999029 143999029 C > - CYP11B2 NM_000498.3:c.228del
NP_000489.3:p.Ile78PhefsTer14
2/13585 7.0e-05 2 frameshift Likely pathogenic
View 8 145736918 145736918 G > A RECQL4 ENST00000428558.2:c.3523C>T
ENSP00000475456.1:p.Gln1175Ter
2/13144 8.0e-05 1 curation Likely pathogenic
View 9 215043 215043 C > A DOCK8 C9orf66 DOCK8 ENST00000453981.1:c.53+14C>A
NM_152569.2:c.354G>T
ENST00000432829.2:c.-152+14C>A
NP_689782.2:p.Ala118=
3/14930 0.0001 3 five_prime_intronic Likely pathogenic
View 9 6534775 6534775 G > T GLDC NM_000170.2:c.2852C>A
NP_000161.2:p.Ser951Tyr
10/14969 0.00033 1 Likely pathogenic
View 9 35095535 35095535 G > - PIGO PIGO PIGO NM_001201484.1:c.28del
NM_152850.3:c.28del
NM_032634.3:c.28del
NP_001188413.1:p.Leu10TrpfsTer65
NP_690577.2:p.Leu10TrpfsTer65
NP_116023.2:p.Leu10TrpfsTer65
2/13144 8.0e-05 2 frameshift Likely pathogenic
View 9 37784804 37784804 C > A EXOSC3 EXOSC3 NM_001002269.2:c.238G>T
NM_016042.3:c.238G>T
NP_001002269.1:p.Val80Phe
NP_057126.2:p.Val80Phe
13/13144 0.00049 1 Likely pathogenic
Displaying 400 through 450 of 530 variants