Download: Excel

Chr Start Stop Change Gene(s) HGVS_C HGVS_P Sample Count CMH MAF ACMG Cat. ACMG Note Curation
View 18 57147460 57147460 A > T CCBE1 NM_133459.3:c.223T>A
NP_597716.1:p.Cys75Ser
1/5119 0.0002 1 Pathogenic
View 19 852978 852978 C > T ELANE NM_001972.2:c.170C>T
NP_001963.1:p.Ala57Val
1/5119 0.0001 1 Pathogenic
View 19 13008527 13008527 G > A GCDH NR_102317.1:n.1474G>A
NM_013976.3:c.1093G>A
NM_000159.3:c.1093G>A
NR_102316.1:n.1256G>A
NP_039663.1:p.Glu365Lys
NP_000150.1:p.Glu365Lys
1/6913 7.0e-05 1 Pathogenic
View 19 13008590 13008590 C > T GCDH NM_013976.3:c.1156C>T
NR_102317.1:n.1537C>T
NM_000159.3:c.1156C>T
NR_102316.1:n.1319C>T
NP_039663.1:p.Arg386Ter
NP_000150.1:p.Arg386Ter
1/6913 7.0e-05 1 Pathogenic
View 19 13008632 13008632 G > A GCDH NR_102317.1:n.1579G>A
NM_013976.3:c.1198G>A
NM_000159.3:c.1198G>A
NR_102316.1:n.1361G>A
NP_039663.1:p.Val400Met
NP_000150.1:p.Val400Met
3/6913 0.00022 1 Pathogenic
View 19 13010300 13010300 C > T GCDH SYCE2 NR_102317.1:n.1643C>T
NM_013976.3:c.1244-214C>T
NM_001105578.1:c.613-101G>A
NM_000159.3:c.1262C>T
NR_102316.1:n.1425C>T
NP_000150.1:p.Ala421Val
1/6913 7.0e-05 1 Pathogenic
View 19 13410109 13410110 - > ACTGGTCCGCTGCTCCCACACGGACTTG CACNA1A NM_001127222.1:c.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT
NM_001127221.1:c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT
NM_001174080.1:c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT
NM_023035.2:c.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT
NM_000068.3:c.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT
NP_001120694.1:p.Glu780GlnfsTer10
NP_001120693.1:p.Glu781GlnfsTer10
NP_001167551.1:p.Glu781GlnfsTer10
NP_075461.2:p.Glu784GlnfsTer10
NP_000059.3:p.Glu784GlnfsTer10
7/5119 0.00068 2 premature_stop Pathogenic
View 19 38987106 38987106 C > T RYR1 NM_000540.2:c.6721C>T
NM_001042723.1:c.6721C>T
NP_000531.2:p.Arg2241Ter
NP_001036188.1:p.Arg2241Ter
4/5308 0.00038 1 Pathogenic
View 19 39071079 39071079 C > T RYR1 NM_000540.2:c.14581C>T
NM_001042723.1:c.14566C>T
NP_000531.2:p.Arg4861Cys
NP_001036188.1:p.Arg4856Cys
1/5308 9.0e-05 1 Pathogenic
View 19 41928275 41928275 G > C BCKDHA NM_001164783.1:c.853G>C
NM_000709.3:c.853G>C
NP_001158255.1:p.Ala285Pro
NP_000700.1:p.Ala285Pro
1/6913 7.0e-05 1 Pathogenic
View 19 41930487 41930487 T > A BCKDHA NM_001164783.1:c.1309T>A
NM_000709.3:c.1312T>A
NP_001158255.1:p.Tyr437Asn
NP_000700.1:p.Tyr438Asn
5/6913 0.00036 1 Pathogenic
View 19 45855805 45855805 T > - ERCC2 NM_000400.3:c.2005del
NP_000391.1:p.Arg669GlyfsTer40
2/6913 0.00014 1 Pathogenic
View 19 45912070 45912070 A > G ERCC1 CD3EAP NM_001166049.1:c.*863T>C
NM_001983.3:c.*863T>C
NM_012099.1:c.844A>G
NP_036231.1:p.Thr282Ala
54/5119 0.00586 5 Common ExAC MAF original cat: TYPE_3 - non_synonymous Pathogenic
View 19 47259533 47259533 C > A FKRP NM_024301.4:c.826C>A
NM_001039885.2:c.826C>A
NP_077277.1:p.Leu276Ile
NP_001034974.1:p.Leu276Ile
19/6913 0.00137 1 Pathogenic
View 19 47983175 47983176 - > ACCGACCACATCTGCAGA KPTN NM_007059.2:c.714_731dupTCTGCAGATGTGGTCGGT
NP_008990.2:p.Met241_Gln246dup
7/5119 0.00068 1 Pathogenic
View 2 15378794 15378794 C > T NBAS NR_052013.2:n.5785G>A
NM_015909.3:c.5741G>A
NP_056993.2:p.Arg1914His
2/5119 0.0002 1 Pathogenic
View 2 15601846 15601846 G > A NBAS NR_052013.2:n.2211C>T
NM_015909.3:c.2167C>T
NP_056993.2:p.Gln723Ter
2/5119 0.0002 1 premature_stop Pathogenic
View 2 39249915 39249915 T > C SOS1 NM_005633.3:c.1654A>G
NP_005624.2:p.Arg552Gly
1/5119 0.0001 1 Pathogenic
View 2 73118535 73118535 C > T SPR NM_003124.4:c.655C>T
NP_003115.1:p.Arg219Ter
2/5119 0.00029 1 Pathogenic
View 2 145157639 145157639 T > - ZEB2 NM_014795.3:c.1115del
NM_001171653.1:c.1043del
NP_055610.1:p.Lys372SerfsTer24
NP_001165124.1:p.Lys348SerfsTer24
1/5771 9.0e-05 1 Pathogenic
View 2 145274844 145274844 C > - ZEB2 NM_001171653.1:c.73+1del
NM_014795.3:c.73+1del
NR_033258.1:n.595+1del
2/5771 0.00017 1 Pathogenic
View 2 152408252 152408252 C > T NEB ENST00000409198.1:c.14841G>A
NM_001271208.1:c.19944G>A
ENST00000397345.3:c.19944G>A
ENST00000427231.2:c.19944G>A
ENST00000409198.1:c.14841G>A(p.%3D)
NM_001271208.1:c.19944G>A(p.%3D)
ENST00000397345.3:c.19944G>A(p.%3D)
ENST00000427231.2:c.19944G>A(p.%3D)
2/6913 0.00014 1 Pathogenic
View 2 163138034 163138034 T > C IFIH1 NM_022168.3:c.1328A>G
NP_071451.2:p.Asp443Gly
1/5119 0.0001 1 non_synonymous Pathogenic
View 2 166245193 166245193 G > A SCN2A NM_021007.2:c.4877G>A
NM_001040142.1:c.4877G>A
NM_001040143.1:c.4877G>A
NP_066287.2:p.Arg1626Gln
NP_001035232.1:p.Arg1626Gln
NP_001035233.1:p.Arg1626Gln
1/5119 0.0001 1 Pathogenic
View 2 179477204 179477204 A > T TTN-AS1 TTN NR_038271.1:n.783-1558A>T
NM_133432.3:c.23228T>A
NM_003319.4:c.22853T>A
NM_001267550.1:c.50048T>A
NM_001256850.1:c.45125T>A
NM_133378.4:c.42344T>A
NM_133437.3:c.23429T>A
NP_597676.3:p.Ile7743Asn
NP_003310.4:p.Ile7618Asn
NP_001254479.1:p.Ile16683Asn
NP_001243779.1:p.Ile15042Asn
NP_596869.4:p.Ile14115Asn
NP_597681.3:p.Ile7810Asn
1/5119 0.0001 1 non_synonymous Pathogenic
View 2 189872665 189872665 G > A COL3A1 ENST00000304636.3:c.3417+1G>A
1/5119 0.0001 1 Pathogenic
View 2 191155151 191155151 T > C HIBCH NM_014362.3:c.365A>G
NM_198047.2:c.365A>G
NP_055177.2:p.Tyr122Cys
NP_932164.1:p.Tyr122Cys
1/6913 0.00014 1 Pathogenic
View 2 207009733 207009733 T > C NDUFS1 NM_001199983.1:c.584A>G
NM_001199984.1:c.797A>G
NM_005006.6:c.755A>G
NM_001199981.1:c.647A>G
NM_001199982.1:c.422A>G
NP_001186912.1:p.Asp195Gly
NP_001186913.1:p.Asp266Gly
NP_004997.4:p.Asp252Gly
NP_001186910.1:p.Asp216Gly
NP_001186911.1:p.Asp141Gly
1/5119 0.0001 1 Pathogenic
View 2 219525876 219525876 C > T BCS1L NM_001257343.1:c.166C>T
NM_004328.4:c.166C>T
NM_001257342.1:c.166C>T
NM_001079866.1:c.166C>T
NM_001257344.1:c.166C>T
NP_001244272.1:p.Arg56Ter
NP_004319.1:p.Arg56Ter
NP_001244271.1:p.Arg56Ter
NP_001073335.1:p.Arg56Ter
NP_001244273.1:p.Arg56Ter
2/6913 0.00014 1 Pathogenic
View 2 228560811 228560811 T > C SLC19A3 NM_025243.3:c.980-14A>G
3/5101 0.00029 1 Pathogenic
View 2 238256455 238256455 G > A COL6A3 NM_057167.3:c.6406C>T
NM_004369.3:c.7024C>T
NM_057166.4:c.5203C>T
NP_476508.2:p.Arg2136Ter
NP_004360.2:p.Arg2342Ter
NP_476507.3:p.Arg1735Ter
2/5771 0.00017 1 Pathogenic
View 2 241813412 241813412 T > C AGXT NM_000030.2:c.613T>C
NP_000021.1:p.Ser205Pro
2/5119 0.0002 1 Pathogenic
View 20 3899342 3899342 G > A PANK2 NM_153640.2:c.688G>A
NM_024960.4:c.688G>A
NM_153638.2:c.1561G>A
NP_705904.1:p.Gly230Arg
NP_079236.3:p.Gly230Arg
NP_705902.2:p.Gly521Arg
6/6913 0.00043 1 Pathogenic
View 20 10653347 10653347 A > G JAG1 NM_000214.2:c.387+2T>C
1/5119 0.0001 1 Pathogenic
View 20 32881889 32881889 G > A AHCY NM_001161766.1:c.209C>T
NM_000687.2:c.293C>T
NP_001155238.1:p.Pro70Leu
NP_000678.1:p.Pro98Leu
3/5119 0.00029 1 Pathogenic
View 20 57478763 57478763 G > A GNAS NM_001077489.2:c.304G>A
NM_016592.2:c.*255G>A
NM_080426.2:c.307G>A
NR_003259.1:n.439G>A
NM_001077488.2:c.352G>A
NM_001077490.1:c.*210G>A
NM_080425.2:c.2278G>A
NM_000516.4:c.349G>A
NP_001070957.1:p.Val102Met
NP_536351.1:p.Val103Met
NP_001070956.1:p.Val118Met
NP_536350.2:p.Val760Met
NP_000507.1:p.Val117Met
1/5119 0.0001 3 non_synonymous Pathogenic
View 20 62044879 62044879 C > T KCNQ2 NM_172106.1:c.1633G>A
NM_172108.3:c.1594G>A
NM_004518.4:c.1603G>A
NM_172107.2:c.1687G>A
NP_742104.1:p.Asp545Asn
NP_742106.1:p.Asp532Asn
NP_004509.2:p.Asp535Asn
NP_742105.1:p.Asp563Asn
1/5119 0.0001 1 Pathogenic
View 20 62070997 62070997 G > A KCNQ2 NM_172109.1:c.881C>T
NM_172106.1:c.881C>T
NM_172108.3:c.881C>T
NM_172107.2:c.881C>T
NM_004518.4:c.881C>T
NP_742107.1:p.Ala294Val
NP_742104.1:p.Ala294Val
NP_742106.1:p.Ala294Val
NP_742105.1:p.Ala294Val
NP_004509.2:p.Ala294Val
1/5119 0.0001 1 Pathogenic
View 21 38128847 38128847 G > A HLCS NM_001242785.1:c.2005C>T
NM_001242784.1:c.2005C>T
NM_000411.6:c.2005C>T
NP_001229714.1:p.His669Tyr
NP_001229713.1:p.His669Tyr
NP_000402.3:p.His669Tyr
1/6913 0.00014 1 non_synonymous Pathogenic
View 22 24919586 24919586 G > A UPB1 NM_016327.2:c.917-1G>A
23/5119 0.00225 1 Pathogenic
View 22 31010403 31010404 TC > - TCN2 NM_000355.3:c.497_498del
NM_001184726.1:c.416_417del
NP_000346.2:p.Leu166ProfsTer7
NP_001171655.1:p.Leu139ProfsTer7
3/5119 0.00029 1 Pathogenic
View 22 40760969 40760969 G > A ADSL NM_000026.2:c.1277G>A
NM_001123378.1:c.1191+600G>A
NP_000017.1:p.Arg426His
11/5119 0.00107 1 Pathogenic
View 22 51065593 51065593 C > T ARSA NM_001085427.2:c.465+1G>A
NM_001085425.2:c.465+1G>A
NM_001085428.2:c.207+1G>A
NM_000487.5:c.465+1G>A
NM_001085426.2:c.465+1G>A
9/6913 0.00065 1 Pathogenic
View 3 15685874 15685874 G > A BTD NM_000060.2:c.511G>A
NP_000051.1:p.Ala171Thr
10/6913 0.00072 1 Pathogenic
View 3 15686693 15686693 G > C BTD NM_000060.2:c.1330G>C
NP_000051.1:p.Asp444His
490/6913 0.03645 1 Pathogenic
View 3 15686852 15686852 C > T BTD NM_000060.2:c.1489C>T
NP_000051.1:p.Pro497Ser
5/6913 0.00036 1 Pathogenic
View 3 38180344 38180346 GGA > - MYD88 NM_001172568.1:c.196_198del
NM_001172566.1:c.196_198del
NM_001172569.1:c.196_198del
NM_001172567.1:c.196_198del
NM_002468.4:c.196_198del
NP_001166039.1:p.Glu66del
NP_001166037.1:p.Glu66del
NP_001166040.1:p.Glu66del
NP_001166038.1:p.Glu66del
NP_002459.2:p.Glu66del
1/6913 0.00014 1 Pathogenic
View 3 38592513 38592513 C > T SCN5A NM_001099405.1:c.5296G>A
NM_000335.4:c.5347G>A
NM_001160161.1:c.5188G>A
NM_001099404.1:c.5350G>A
NM_198056.2:c.5350G>A
NM_001160160.1:c.5251G>A
NP_001092875.1:p.Glu1766Lys
NP_000326.2:p.Glu1783Lys
NP_001153633.1:p.Glu1730Lys
NP_001092874.1:p.Glu1784Lys
NP_932173.1:p.Glu1784Lys
NP_001153632.1:p.Glu1751Lys
2/5308 0.00019 1 Pathogenic
View 3 81698005 81698005 A > G GBE1 ENST00000429644.2:c.691+2T>C
15/6913 0.00108 1 Pathogenic
View 3 182810333 182810333 C > T MCCC1 NM_020166.3:c.137G>A
NP_064551.3:p.Gly46Glu
5/5119 0.00049 1 Pathogenic
Displaying 150 through 200 of 332 variants